>Corresponsing Author : Michel Leclerc

>Article Type : Original Research Article

>Volume : 1   |   Issue : 1

>Received Date : 16 August, 2021

>Accepted Date : 31 August, 2021

>Published Date : 3 September, 2021

>DOI : http://dx.doi.org/JCCI2100101


>Citation : Leclerc M (2021) Biosynthesis « De Novo » of the Ophuirid Ophiocomina Nigra Igkappa Gene. J Clin Class Immunol 1(1): doi http://dx.doi.org/JCCI2100101  

>Copyright : 2021 Leclerc M. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Full Text

Original Research Article | Open Access

Michel Leclerc

Immunology of Invertebrates, Biology/Biochemistry, Orleans University, France

*Corresponding author: Michel Leclerc, Immunology of Invertebrates, Biology/Biochemistry, Orleans University, France


Abstract


A biosynthesis « de novo » of the ophuirid Ophiocomina nigra IGKappa gene was performed in our laboratory. This gene was inserted into pUC-GW plasmid by using the unique restriction site. The synthetized nucleotide sequence was identical to the original one.
We concluded to the validity of the experiment.The unique ancestral IGKappa gene and the corresponding protein (IGKappa) possesses immunoglobulin sites

Keywords: IGKappa; pUC-GW

Abbreviations: PCA: poly chain assembly method, DNA: Deoxyribonucleic acid.

Introduction


In recent papers [1] we have presented the sequence of Ophiocomina nigra IGKappa gene as following (in 5’- 3’): It presented 1019 bp.

BC030813.1 GAGGAACTGCTCAGTTAGGACCCAGACGGAACCATGGAAGCCCCAGCGCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGATACCACTGGAGAAATAGTGATGACGCAGTCTCCAGCCACCCTGTCTGTGTCTCCAGGGGAAAGAGCCACCCTCTCCTGCAGGGCCAGTCAGAGTGTTACCAGCAACTTAGCCTGGTACCAGCAGACACCTGGGCAGTCTCCCAGGCTCGTCATCTATGGTGCATCCAGCAGGGCCAGTGGTGTCCCAGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGAGTTCACTCTCACCATCAGCAGCCTGCAGTCTGAAGATTTTGCAGTTTATTACTGTCAGCAGTATAATAAGTGGCCGCACACTTTTGGCCAGGGGACCAAGCTGGACATCAAACGAACTGTGGCTGCACCATCTGTCTTCATCTTCCCGCCATCTGATGAGCAGTTGAAATCTGGAACTGCCTCTGTTGTGTGCCTGCTGAATAACTTCTATCCCAGGGAGGCCAAAGTACAGTGGAAGGTGGATAACGCCCTCCAATCGGGTAACTCCCAGGAGAGTGTCACAGAGCAGGACAGCAAGGACAGCACCTACAGCCTCAGCAGCACCCTGACGCTGAGCAAAGCAGACTACGAGAAACACAAAGTCTACGCCTGCGAAGTCACCCATCAGGGCCTGAGCTCGCCCGTCACAAAGAGCTTCAACAGGGGAGAGTGTTAGAGGGAGAAGTGCCCCCACCTGCTCCTCAGTTCCAGCCTGACCCCCTCCCATCCTTTGGCCTCTGACCCTTTTTCCACAGGGGACCTACCCCTATTGCGGTCCTCCAGCTCATCTTTCACCTCACCCCCCTCCTCCTCCTTGGCTTTAATTATGCTAATGTTGGAGGAGAATGAATAAATAAAGTGAATCTTTGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

We have tried, in the present paper, to synthetize the corresponding gene « de novo », according to the method we describe now:

Materials and Methods:


We have used the following gene synthesis method:

1. Synthesis of oligonucleotides with overlapping segments in sense and antisense direction
2. Assembly of the oligonucleotides into a double stranded DNA, using a poly chain assembly method (PCA).
3. For larger constructs, the sequence is split into smaller, intermediate fragments, to facilitate synthesis. Once the intermediated fragments have been obtained with correct sequence, they are assembled into the full-length sequence.
4. Cloning into the linearized vector by either recombination or ligation based cloning, mostly performed within the same step as full-length sequence assembly.

Regarding the restriction site, which was used for cloning, construct BC030813.1 was cloned into vector pUC-GW by using the unique EcoRV restriction site. The final construct sequence was achieved after use of primers (Table 1).

  Table 1: Primers used for sequencing

M13F-77 GATGTGCTGCAAGGCGATTA
M13R-88 TTATGCTTCCGGCTCGTATG
U-SEQ4883 CCTCCAATCGGGTAACTC

Results:


Plasmid map:


Original sequence:


GAGGAACTGCTCAGTTAGGACCCAGACGGAACCATGGAAGCCCCAGCGCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGATACCACTGGAGAAATAGTGATGACGCAGTCTCCAGCCACCCTGTCTGTGTCTCCAGGGGAAAGAGCCACCCTCTCCTGCAGGGCCAGTCAGAGTGTTACCAGCAACTTAGCCTGGTACCAGCAGACACCTGGGCAGTCTCCCAGGCTCGTCATCTATGGTGCATCCAGCAGGGCCAGTGGTGTCCCAGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGAGTTCACTCTCACCATCAGCAGCCTGCAGTCTGAAGATTTTGCAGTTTATTACTGTCAGCAGTATAATAAGTGGCCGCACACTTTTGGCCAGGGGACCAAGCTGGACATCAAACGAACTGTGGCTGCACCATCTGTCTTCATCTTCCCGCCATCTGATGAGCAGTTGAAATCTGGAACTGCCTCTGTTGTGTGCCTGCTGAATAACTTCTATCCCAGGGAGGCCAAAGTACAGTGGAAGGTGGATAACGCCCTCCAATCGGGTAACTCCCAGGAGAGTGTCACAGAGCAGGACAGCAAGGACAGCACCTACAGCCTCAGCAGCACCCTGACGCTGAGCAAAGCAGACTACGAGAAACACAAAGTCTACGCCTGCGAAGTCACCCATCAGGGCCTGAGCTCGCCCGTCACAAAGAGCTTCAACAGGGGAGAGTGTTAGAGGGAGAAGTGCCCCCACCTGCTCCTCAGTTCCAGCCTGACCCCCTCCCATCCTTTGGCCTCTGACCCTTTTTCCACAGGGGACCTACCCCTATTGCGGTCCTCCAGCTCATCTTTCACCTCACCCCCCTCCTCCTCCTTGGCTTTAATTATGCTAATGTTGGAGGAGAATGAATAAATAAAGTGAATCTTTGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

Synthetized sequence:


GAGGAACTGCTCAGTTAGGACCCAGACGGAACCATGGAAGCCCCAGCGCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGATACCACTGGAGAAATAGTGATGACGCAGTCTCCAGCCACCCTGTCTGTGTCTCCAGGGGAAAGAGCCACCCTCTCCTGCAGGGCCAGTCAGAGTGTTACCAGCAACTTAGCCTGGTACCAGCAGACACCTGGGCAGTCTCCCAGGCTCGTCATCTATGGTGCATCCAGCAGGGCCAGTGGTGTCCCAGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGAGTTCACTCTCACCATCAGCAGCCTGCAGTCTGAAGATTTTGCAGTTTATTACTGTCAGCAGTATAATAAGTGGCCGCACACTTTTGGCCAGGGGACCAAGCTGGACATCAAACGAACTGTGGCTGCACCATCTGTCTTCATCTTCCCGCCATCTGATGAGCAGTTGAAATCTGGAACTGCCTCTGTTGTGTGCCTGCTGAATAACTTCTATCCCAGGGAGGCCAAAGTACAGTGGAAGGTGGATAACGCCCTCCAATCGGGTAACTCCCAGGAGAGTGTCACAGAGCAGGACAGCAAGGACAGCACCTACAGCCTCAGCAGCACCCTGACGCTGAGCAAAGCAGACTACGAGAAACACAAAGTCTACGCCTGCGAAGTCACCCATCAGGGCCTGAGCTCGCCCGTCACAAAGAGCTTCAACAGGGGAGAGTGTTAGAGGGAGAAGTGCCCCCACCTGCTCCTCAGTTCCAGCCTGACCCCCTCCCATCCTTTGGCCTCTGACCCTTTTTCCACAGGGGACCTACCCCTATTGCGGTCCTCCAGCTCATCTTTCACCTCACCCCCCTCCTCCTCCTTGGCTTTAATTATGCTAATGTTGGAGGAGAATGAATAAATAAAGTGAATCTTTGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

  We give now the Blastn original sequence/ synthetized sequence results:

Size Seq1 Size Seq2 Max score Total score Query cover E. Value Per. Ident Acc Len
1019 1019 1882 1882 100% 0.0 100% 1019

Conclusion Discussion:


The synthesized nucleotide sequence is identical to the original sequence. It is therefore valid.
In conclusion, we have obtained with success an IGKAPPA Gene with its unique IGKAPPA protein.
Additionally, the existence of members of IGKappa genes with IG sites in Invertebrates and particularly in Echinodermata [2] (Ophuirids, Asterids) constitute an excellent opportunity to explore relations of molecular structures and biochemical and physiological function of these unique proteins.

References


  1. Leclerc M, Marie Y, Davoult D, Jolly A, Grange P (2018) A true new gene in ophiocomina nigra: an ophuirid Igkappa gene. Appl Biotechnol Bioeng. 5(1): 17-18. [Ref.]
  2. Vincent N, Osteras M, Otten P, Leclerc M (2014) A new gene in A. rubens: A sea star Ig kappa gene. Meta Gene. 2: 320-322. [Ref.]

cover-image