>Corresponsing Author : Michel Leclerc

>Article Type : Brief Report Article

>Volume : 1   |   Issue : 1

>Received Date : 22 September, 2021

>Accepted Date : 6 October, 2021

>Published Date : 9 October, 2021

>DOI : https://doi.org/10.54289/JCCI2100103


>Citation : Leclerc M (2021) E IG V-L K appa Expression from Sea Star Igkappa Gene. J Clin Class Immunol 1(1). doi https://doi.org/10.54289/JCCI2100103  

>Copyright : 2021 Leclerc M. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Full Text

Brief Report Article | Open Access

Michel Leclerc*

Immunology of Invertebrates, Biology/Biochemistry, Orleans University, France

*Corresponding author: Michel Leclerc, Immunology of Invertebrates, Biology/Biochemistry, Orleans University, France


Abstract


The sea star IGKappa gene was cloned in 2014 by the use of primers. It was compared in the present work to Vertebrate Immunoglobulin genes. A high identity was found with these last ones. A length of 105 amino acids fit with Immunoglobulin domain.

Introduction


The sequence of the sea star Asterias rubens IGKappa gene was described by our team, in 2014 [1]. Since we have tried to find homologies between this gene and upper genes from lower Vertebrates to human genes.
We report, in the precedent paper, results obtained with upper Vertebrate genes by the use of blasts directed against these last ones [2, 3].

Results:


The sequence of the sea star IGKappa gene is the following [1]:
5’GGATCCGGAGGAATGCGTGGCAACATGGCGTCTCTATGGATGTTCTTCTTTGTCGTGGGGATAACTTTACAACGGAGTTTGGCGATTTACACGTTTCGCAGCAACCGTCGGACACTAGCGCGTTGCAGGGGAGCACAGTGGTGCTTCACTGCTCCGTTGAGCAGTACATAAACACCACGGCCATCGTTTGGTGGAGCCGTGACTCGGTCATCAGCCACAACAAAGACCTGAAACTGTCCAGTCTAAACACCGACCAGCTCCAAAGGTACTCGATTTCAGGCGACGCATCTCGGGGGGAATTCAACCTTAAAATAGTGAACTTTACCGCCACAGACGCCGCCAGTTACCGCTGTCAGATGTAAGAATTC3’

The bioinformatic work leads us to show similarities between sea star IGKappa gene and Immunoglobulin domain from Vertebrates


Non-specific hits: IgV_L_Kappa
[Non-specific hit, evalue = 6.79e-03] cd04980, Immunoglobulin (Ig) light chain, kappa type, variable (V) domain; The members here are composed of the immunoglobulin (Ig) light chain, kappa type, variable (V) domain. This group contains the standard Ig superfamily V-set AGFCC'C"/DEB domain topology.]
Super-families: Ig superfamily
[Superfamily, evalue = 6.79e-03] cl11960, Immunoglobulin domain; The members here are composed of the immunoglobulin (Ig) domain found in the Ig superfamily.]
The Table 1, as shown below, resumes our results: We observe again the Immunoglobulin domain and a particular one without immune function.

Figure 2: PREDICTED: Asterias rubens uncharacterized LOC117296905 (LOC117296905).


Two region features:
a. Region Ig
Comment: Immunoglobulin
Location: 47…151
Length: 105 aa
CDD: 214652

b. COG5644
Comment: U3 small nucleolar RNA-associated protein 14 (function unknown)
Location: 731…866
Length: 136 aa
CDD: 227931

Conclusion:


We retain from this bioinformatic analysis, the presence of Immunoglobulin domain in the sea star IGKappa gene with the CDD:214652. This gene, nevertheless, seems less evolved that the Ophuirid IGKappa gene we discovered 1 month ago [4] in terms of Immune functions.
These 2 genes from Echinodermata (Invertebrates) bring us a new light in Immunogenetic World and mainly in Comparative Immunology between Invertebrates and Vertebrates animals.

References


  1. Vincent N, Osteras M, Otten P, Leclerc M (2014)A new gene in A. rubens: A sea star Ig kappa gene. Meta Gene 2:320-322. [Ref.]
  2. Marchler-Bauer A, Bo Y, Han L, He J, et al. (2017)CDD/SPARCLE: functional classification of proteins via subfamily domain architectures. Nucleic Acid Res 45 (D1): 200-203. [PubMed.]
  3. Marchler-Bauer A, Lu S, Anderson JB, Chitsaz F, Derbyshire MK, et al. (2011)CDD: a Conserved Domain Database for the functional annotation of proteins. Nucleic Acid Res 39(D): 225-229. [PubMed.]
  4. Leclerc M. (2021) Biosynthesis « De Novo » of the Ophuirid Ophiocomina Nigra Igkappa Gene. J Clin Class Immunol 1(1). [Ref.]

cover-image